TY - JOUR
T1 - Erratum
T2 - Formation of a viral replication focus in Sulfolobus cells infected by the rudivirus Sulfolobus islandicus rod-shaped virus 2 [Journal of Virology, 91, 13, (2017), (e00486-17)] DOI:10.1128/JVI.00486-17
AU - Martínez-Alvarez, Laura
AU - Deng, Ling
AU - Peng, Xu
N1 - Publisher Copyright:
© 2018 American Society for Microbiology.
PY - 2018/4/1
Y1 - 2018/4/1
N2 - Volume 91, no. 13, e00486-17, 2017, https://doi.org/10.1128/JVI.00486-17. Page 10, Table 2, line 1: The sequence for oligonucleotide "Spacer dpo1 F" should read "AAAG TTGGGTACTTTACCTACTTTATCTGGTTCAAGATCTACTA".
AB - Volume 91, no. 13, e00486-17, 2017, https://doi.org/10.1128/JVI.00486-17. Page 10, Table 2, line 1: The sequence for oligonucleotide "Spacer dpo1 F" should read "AAAG TTGGGTACTTTACCTACTTTATCTGGTTCAAGATCTACTA".
UR - http://www.scopus.com/inward/record.url?scp=85043757422&partnerID=8YFLogxK
U2 - 10.1128/JVI.01991-17
DO - 10.1128/JVI.01991-17
M3 - Comment/debate
C2 - 29540560
AN - SCOPUS:85043757422
VL - 92
JO - Journal of Virology
JF - Journal of Virology
SN - 0022-538X
IS - 7
M1 - e01991-17
ER -